Primer sequences table. | Download Table
Table 1 from Guelph Guelph , ON , Canada Single-Primer Amplification of Flanking Sequences | Semantic Scholar
Supplementary Table 2: Primer sequences and DHPLC conditions
View Image
Table S6. List of primers (Sequence 5' to 3') used in this study.
Table 2. Primer sequences and PCR protocol used for the RT-PCR assay : Benzoin Thiosemicarbazone Inhibits Growth and Triggers Apoptosis in Earlich Ascites Carcinoma Cells through an Intrinsic Pathway : Science and
JCI - E-cadherin expression on multiple myeloma cells activates tumor-promoting properties in plasmacytoid DCs
Table of primers a Primer name Base position b Sequence 533 | Download Table
View Image
Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies | PLOS ONE
Supplementary Table 2. Primer List Primer Description Sequence
Table of RT-PCR primer sequences | Download Table
Scientific Protocols - SARS PCR/Sequencing Primers
Primer Sequence for Quantitative PCR | Download Table
Primer sequence for qRT-PCR. | Download Table
Supplementary Table 1: primer sequences - ppt download
The primer sequences for qRT-PCR. | Download Table
PPT - Supplementary Table 2: Primers for constructing and sequencing pFex. PowerPoint Presentation - ID:4582870
Table S1. List of primers used in study. Name of Primer Sequence of
PCR Primer Sequences | Download Table
Table S3. Primers Used for SURVEYOR Assays, Related to Experimental Procedures primer name genomic target primer sequence (5'
Table SI. Primer sequences for RT‑qPCR. Product Forward primer sequence Reverse primer sequence IL‑6 GAGGATACCACTCCCAACAGACC
Khilko-2018. Nice paper. | by Eli Lyons | Medium
